Order Score NCBI        EMBL  Seed/Full   Blast Description
--------------------------------------------------------------------------------
1)    2694  NC_007025   DQ010921    none  Yes   Feline coronavirus
2)    2694  xxxxxxxx    AY994055    none  Yes   Feline infectious peritonitis virus, complete genome.
3)    1760  NC_006577   AY597011    none   No   Human coronavirus HKU1
4)    1568  xxxxxxxx    AY851295    none  No   Avian infectious bronchitis virus strain Mass 41, complete genome.
5)    1565  xxxxxxxx    AY910861    none  No   Synthetic construct murine hepatitis virus, complete genome
6)    1564  xxxxxxxx    DQ001339    none  No   Avian infectious bronchitis virus isolate IBV-p65, complete genome.
7)    1564  xxxxxxxx    DQ001338    none  No   Avian infectious bronchitis virus isolate IBV-EP3, complete genome.
8)    1562  xxxxxxxx    AY700211    none  No   Murine hepatitis virus strain A59
9)    1543  NC_006852   xxxxxxxx    none  No   Murine hepatitis virus strain JHM
10)   1515  xxxxxxxx    AY686863    none  No   SARS coronavirus A022, complete genome.
11)   1515  xxxxxxxx    AY686864    none  No   SARS coronavirus B039, complete genome.

---------------------------------------------------------------------------
No. 1
GENOME: Feline coronavirus, strand+
NCBI:   NC_007025
EMBL:   DQ010921
Score:  2694

                ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................
Query: 0        GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGCAAUGGUACUGAUCCAGACCAUG 59
                ||||||***********||*****|***********| ||||||||||||||||||||||
Sbjct: 12179    GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGUAAUGGUACUGAUCCAGACCAUG 12238
                ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                ......bbbbb........
Query: 60       UUAGUAGAGCUUUUGACAU 78
                ||||||*****||||||||
Sbjct: 12239    UUAGUAGAGCUUUUGACAU 12257
                ......bbbbb........


---------------------------------------------------------------------------
No. 2
GENOME: Feline infectious peritonitis virus, complete genome.
NCBI: xxxxxxxx
EMBL: AY994055
Score:      2694

                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................
Query: 0          GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGCAAUGGUACUGAUCCAGACCAUG 59
                  ||||||***********||*****|***********| ||||||||||||||||||||||
Sbjct: 12409      GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGUAAUGGUACUGAUCCAGACCAUG 12468
                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                  ......bbbbb........
Query: 60         UUAGUAGAGCUUUUGACAU 78
                  ||||||*****||||||||
Sbjct: 12469      UUAGUAGAGCUUUUGACAU 12487
                  ......bbbbb........


---------------------------------------------------------------------------
No. 3
GENOME: Human coronavirus HKU1
NCBI:   NC_006577
EMBL:   AY597011
Score:  1760

                ......AAAAAAAAAAA..   BBBBB.aaaaaaaaaaa.  ... ..............
Query: 0        GAGUGCGGGGUUCUAGUGC---AGCUCGACUAGAACCCUG--CAA-UGGUACUGAUCCAG 53
                | || |*****+*****|    +**+*|+****+*****|  | | ||||  | |||
Sbjct: 13600    GGGUUCGGGGUACUAGUGUGAAUGCCCGGCUAGUACCCUGUGCUAGUGGU-UU-AUCU-- 13655
                ......AAAAAAAAAAA.....BBBBB.aaaaaaaaaaa.....................


                ... ..... ... . bbbbb........
Query: 54       ACC-AUGUU-AGU-A-GAGCUUUUGACAU 78
                ||  ||||| | | | *+**+||||||||
Sbjct: 13656    ACUGAUGUUCAAUUAAGGGCAUUUGACAU 13684
                ................bbbbb........


---------------------------------------------------------------------------
No. 4
GENOME: Avian infectious bronchitis virus strain Mass 41, complete genome.
NCBI: xxxxxxxx
EMBL: AY851295
Score:      1568

                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa  .. ........ ..........
Query: 0          GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCU--GC-AAUGGUAC-UGAUCCAGAC 55
                  | || |*****+++***| +****|+**+++****+  || ||||| |  ||| || ||
Sbjct: 12360      GGGUACGGGGUAGCAGUGAGGCUCGGCUGAUACCCCUAGCUAAUGG-AUGUGACCCCGA- 12417
                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                  ..........    bbbbb........
Query: 56         CAUGUUAGUA----GAGCUUUUGACAU 78
                    |||| |||    ****+|||||  |
Sbjct: 12418      --UGUU-GUAAAGCGAGCCUUUGAUGU 12441
                  ..............bbbbb........


---------------------------------------------------------------------------
No. 5
GENOME: Synthetic construct murine hepatitis virus, complete genome
NCBI: xxxxxxxx
EMBL: AY910861
Score:      1565

                  ......AAAAAAAAAAA..   BBBBB.aaaaaaaaaaa.  . ................
Query: 0          GAGUGCGGGGUUCUAGUGC---AGCUCGACUAGAACCCUG--C-AAUGGUACUGAUCCAG 53
                  | || |*****+*+***|    +**+*|+**+*+*****|  | | |||    ||  | |
Sbjct: 13601      GGGUUCGGGGUACAAGUGUAAAUGCCCGUCUUGUACCCUGUGCCAGUGGCUUGGACACUG 13660
                  ......AAAAAAAAAAA.....BBBBB.aaaaaaaaaaa.....................


                  ........ ... . bbbbb........
Query: 54         ACCAUGUU-AGU-A-GAGCUUUUGACAU 78
                  |   |||| | | | *+**+||||||||
Sbjct: 13661      A---UGUUCAAUUAAGGGCAUUUGACAU 13685
                  ...............bbbbb........


---------------------------------------------------------------------------
No. 6
GENOME: Avian infectious bronchitis virus isolate IBV-p65, complete genome.
NCBI: xxxxxxxx
EMBL: DQ001339
Score:      1564

                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa  .... ...... ..........
Query: 0          GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCU--GCAA-UGGUAC-UGAUCCAGAC 55
                  | || |*****+++***| +****|+**+++****+  || | ||| |  |||||| ||
Sbjct: 12351      GGGUACGGGGUAGCAGUGAGGCUCGGCUGAUACCCCUUGCUAGUGG-AUGUGAUCCUGA- 12408
                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                  ..........    bbbbb........
Query: 56   CAUGUUAGUA----GAGCUUUUGACAU 78
                    |||| |||    ****+|||||  |
Sbjct: 12409      --UGUU-GUAAAGCGAGCCUUUGAUGU 12432
                  ..............bbbbb........


---------------------------------------------------------------------------
No. 7
GENOME: Avian infectious bronchitis virus isolate IBV-EP3, complete genome.
NCBI: xxxxxxxx
EMBL: DQ001338
Score:      1564

                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa  .... ...... ..........
Query: 0          GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCU--GCAA-UGGUAC-UGAUCCAGAC 55
                  | || |*****+++***| +****|+**+++****+  || | ||| |  |||||| ||
Sbjct: 12354      GGGUACGGGGUAGCAGUGAGGCUCGGCUGAUACCCCUUGCUAGUGG-AUGUGAUCCUGA- 12411
                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                  ..........    bbbbb........
Query: 56         CAUGUUAGUA----GAGCUUUUGACAU 78
                    |||| |||    ****+|||||  |
Sbjct: 12412      --UGUU-GUAAAGCGAGCCUUUGAUGU 12435
                  ..............bbbbb........


---------------------------------------------------------------------------
No. 8
GENOME: Murine hepatitis virus strain A59
NCBI: xxxxxxxx
EMBL: AY700211
Score:      1562


                  ......AAAAAAAAAAA..   BBBBB.aaaaaaaaaaa.  . ................
Query: 0          GAGUGCGGGGUUCUAGUGC---AGCUCGACUAGAACCCUG--C-AAUGGUACUGAUCCAG 53
                  || | |*****+*+***|    +**+*|+**+*+*****|  | | |||    ||  | |
Sbjct: 13603      GAUU-CGGGGUACAAGUGUAAAUGCCCGUCUUGUACCCUGUGCCAGUGGCUUGGACACUG 13661
                  ......AAAAAAAAAAA.....BBBBB.aaaaaaaaaaa.....................


                  ........ ... . bbbbb........
Query: 54         ACCAUGUU-AGU-A-GAGCUUUUGACAU 78
                  |   |||| | | | *+**+||||||||
Sbjct: 13662      A---UGUUCAAUUAAGGGCAUUUGACAU 13686
                  ...............bbbbb........


---------------------------------------------------------------------------
No. 9
GENOME: Murine hepatitis virus strain JHM
NCBI: NC_006852
EMBL: xxxxxxxx
Score:      1543

                  ......AAAAAAAAAAA..   BBBBB.aaaaaaaaaaa.  . ................
Query: 0          GAGUGCGGGGUUCUAGUGC---AGCUCGACUAGAACCCUG--C-AAUGGUACUGAUCCAG 53
                  | || |*****+*+***|    +**+*|+**+*+*****|  | | |||    ||  | |
Sbjct: 13618      GGGUUCGGGGUACAAGUGUAAAUGCCCGUCUUGUACCCUGUGCCAGUGGCUUGGACACUG 13677
                  ......AAAAAAAAAAA.....BBBBB.aaaaaaaaaaa.....................


                  ........ ... . bbbbb........
Query: 54         ACCAUGUU-AGU-A-GAGCUUUUGACAU 78
                  |   |||| | | | *+**+||||| ||
Sbjct: 13678      A---UGUUCAAUUAAGGGCAUUUGAUAU 13702
                  ...............bbbbb........


---------------------------------------------------------------------------
No. 10
GENOME: SARS coronavirus A022, complete genome.
NCBI: xxxxxxxx

EMBL: AY686863
Score:      1515

                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa.   ....................
Query: 0          GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUG---CAAUGGUACUGAUCCAGACC 56
                  | ||  *+***+++***||***+*|+**+++***+*|   ||  || |||  | | || 
Sbjct: 13347      GGGUUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUG 13406
                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                  .... .....bbbbb........
Query: 57         AUGU-UAGUAGAGCUUUUGACAU 78
                    || ||  |*+***||||| ||
Sbjct: 13407      UCGUCUA-CAGGGCUUUUGAUAU 13428
                  ..........bbbbb........


---------------------------------------------------------------------------
No. 11
GENOME: SARS coronavirus B039, complete genome.
NCBI: xxxxxxxx
EMBL: AY686864
Score:      1515

                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa.   ....................
Query: 0          GAGUGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUG---CAAUGGUACUGAUCCAGACC 56
                  | ||  *+***+++***||***+*|+**+++***+*|   ||  || |||  | | || 
Sbjct: 13357      GGGUUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUG 13416
                  ......AAAAAAAAAAA..BBBBB.aaaaaaaaaaa........................


                  .... .....bbbbb........
Query: 57         AUGU-UAGUAGAGCUUUUGACAU 78
                    || ||  |*+***||||| ||
Sbjct: 13417      UCGUCUA-CAGGGCUUUUGAUAU 13438
                  ..........bbbbb........


---------------------------------------------------------------------------