Order   Score   NCBI          EMBL        Seed/Full      Blast    Description

----------------------------------------------------------------------------------------

1)      2583    xxxxxxxx     AY994055    none    Yes Feline infectious peritonitis virus, complete genome

2)      1514    xxxxxxxx     AB097865    none    No   Human immunodeficiency virus 1 proviral DNA, nearly complete genome, isolate:mIDU502

3)      1479    NC_004156    AF451898    none    No   Heliothis zea virus 1, complete genome

4)      1477    xxxxxxxx     AB097872    none    No   Human immunodeficiency virus 1 proviral DNA, complete genome, isolate:mCSW105

5)      1454    NC_001559    M35027      none    No   Vaccinia virus, complete genome

6)      1453    xxxxxxxx     AF453392    none    No   Potato leafroll virus strain CIP01, complete genome

7)      1443    xxxxxxxx     AB052995    none    No   Human immunodeficiency virus type 1 subtype E, complete genome, isolate:93JP-NH1

8)      1442    NC_006883    AY939844    none    No   Cyanophage P-SSM2

9)      1439    NC_005902    AY380826    none    No   Lymphocystis disease virus - isolate China

10)     1437    xxxxxxxx     AF105220    none    No   Ovine pulmonary adenocarcinoma virus, complete genome

11)     1436    xxxxxxxx     AF443097    none    No   HIV-1 isolate 00BW1795.6 from Botswana, complete genome

12)     1434    xxxxxxxx     AY009089    none    No   Camelpox virus CMS, complete genome

13)     1426    xxxxxxxx     AB070352    none    No   Human immunodeficiency virus type 1 genomic RNA, complete genome, clone:93JP-NH2.5T

14)     1426    xxxxxxxx     AB070353    none    No   Human immunodeficiency virus type 1 genomic RNA, complete genome, clone:93JP-NH2env

15)     1417    xxxxxxxx     AY008714    none    No   HIV-1 isolate 97CNGX-2F from China, complete genome

16)     1417    xxxxxxxx     AF197339    none    No   HIV-1 isolate 93TH065 from Thailand, complete genome

17)     1411    xxxxxxxx     AY082968    none    No   HIV-1 isolate TH 13-26 from Thailand, complete genome

18)     1409    xxxxxxxx     AY125894    none    No   HIV-1 isolate 97TH6-107 from Thailand, complete genome

19)     1403    xxxxxxxx     AB078005    none    No   Human immunodeficiency virus 1 DNA, complete genome, clone:ARES2

20)     1402    NC_002642    AJ293568    none    No   Yaba-like disease virus

 

 

------------------------------ALIGNMENTS-----------------------------------

No. 1

GENOME: Feline infectious peritonitis virus, complete genome

NCBI: xxxxxxxx

EMBL: AY994055

Score: 2583

 

                  ....AAAAAAAA..............BBBBBBBBBB..aaaaaaaa...bbbbbbbbbb.

Query: 0          CUACUCUUGUACAGAAUGGUAAGCACGUGUAAUAGGAGGUACAAGCCACCCUAUUGCAUA 59

                  ||||********||||||||||||||**********||******** ||**********|

Sbjct: 29137      CUACUCUUGUACAGAAUGGUAAGCACGUGUAAUAGGAGGUACAAGCAACCCUAUUGCAUA 29196

                  ....AAAAAAAA..............BBBBBBBBBB..aaaaaaaa...bbbbbbbbbb.

 

 

                  ...

Query: 60         UUA 62

                  |||

Sbjct: 29197      UUA 29199

                  ...

 

 

---------------------------------------------------------------------------

No. 2

GENOME: Human immunodeficiency virus 1 proviral DNA, nearly complete genome, isolate:mIDU502

NCBI: xxxxxxxx

EMBL: AB097865

Score: 1514

 

                  .... AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa. ..bbbbbbbb

Query: 0          CUAC-UCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCC-ACCCUAUUGC 56

                  | |  +*+****+   || | | || | +++*******||+**+***+  | *+*****+

Sbjct: 6551       CCAGGACAUGUAUUCUAUAGAACAGGAGACAUAAUAGGAGAUAUAAGAAGAGCAUAUUGU 6610

                  .....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  ++ || |

Sbjct: 6611       GAAAUCA 6617

                  bb.....

 

 

---------------------------------------------------------------------------

No. 3

GENOME: Heliothis zea virus 1

NCBI: NC_004156

EMBL: AF451898

Score: 1479

 

                  ....AAAAAAAA..............BBBBBBBBBB .. aaaaaaaa.   ..bbbbbb

Query: 0          CUACUCUUGUACAGAAUGGUAAGCACGUGUAAUAGG-AG-GUACAAGCC---ACCCUAUU 54

                   || +******* | ||  ||   | *****++*++ || ***+***+    | +++***

Sbjct: 218887     -UA-ACUUGUACUGUAU-AUAU-UA-GUGUAUAAAUUAGUGUAUAAGAGUGUAUAUGAUU 218941

                  ....AAAAAAAA..............BBBBBBBBBB....aaaaaaaa......bbbbbb

 

 

                  bbbb..  ..

Query: 55         GCAUAU--UA 62

                  *+**||  ||

Sbjct: 218942     GUAUAUAGUA 218951

                  bbbb......

 

 

---------------------------------------------------------------------------

No. 4

GENOME: Human immunodeficiency virus 1 proviral DNA, complete genome, isolate:mCSW105

NCBI: xxxxxxxx

EMBL: AB097872

Score: 1477

 

                  .... AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbb

Query: 0          CUAC-UCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGC 56

                  | |  +*++***+   || | | || | +++*******||+**+***+||  *+*****+

Sbjct: 7177       CCAGGACAAGUAUUCUAUAGAACAGGAGACAUAAUAGGAGAUAUAAGACAAGCAUAUUGU 7236

                  .....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  ++ ||||

Sbjct: 7237       GAGAUUA 7243

                  bb.....

 

 

---------------------------------------------------------------------------

No. 5

GENOME: Vaccinia virus, complete genome.

NCBI: NC_001559

EMBL: M35027

Score: 1454

 

                  ....AAAAAAAA ..... ....   .....BBBBBBBBBB ..aaaaaaaa...bbbbb

Query: 0          CUACUCUUGUAC-AGAAU-GGUA---AGCACGUGUAAUAGG-AGGUACAAGCCACCCUAU 53

                   || **+*+**+ ||  | ||||   |||  *********+ ||+**+*+++ | +****

Sbjct: 175598     -UAAUCAUAUAAUAGUGUAGGUACUCAGCCGGUGUAAUAGAUAGAUAUAUAUAAUUCUAU 175656

                  ....AAAAAAAA...................BBBBBBBBBB...aaaaaaaa...bbbbb

 

 

                  bbbbb         ....

Query: 54         UGCAU---------AUUA 62

                  *+**+         ||||

Sbjct: 175657     UACACCGGCAGACAAUUA 175674

                  bbbbb.............

 

 

---------------------------------------------------------------------------

No. 6

GENOME: Potato leafroll virus strain CIP01, complete genome

NCBI: xxxxxxxx

EMBL: AF453392

Score: 1453

 

                  ....AAAAAAAA. .....          ........  BBBBBBBBBB..aaaaaaaa.

Query: 0          CUACUCUUGUACA-GAAUG----------GUAAGCAC--GUGUAAUAGGAGGUACAAGCC 46

                   || +++***+*| || ||          |||||| |  +***+++***| *+*+*+*+

Sbjct: 5666       -UAAAUCUGUUCAUGAUUGUAACCGUAAAGUAAGCUCGCUUGUUGCAGGA-GGAGAGGAA 5723

                  ....AAAAAAAA...........................BBBBBBBBBB..aaaaaaaa.

 

 

                  ..bbbbbbbbbb....

Query: 47         ACCCUAUUGCAUAUUA 62

                  | ***+*****+ |||

Sbjct: 5724       AACCUGUUGCAA-UUA 5738

                  ..bbbbbbbbbb....

 

 

---------------------------------------------------------------------------

No. 7

GENOME: Human immunodeficiency virus type 1 subtype E, complete genome, isolate:93JP-NH1

NCBI: xxxxxxxx

EMBL: AB052995

Score: 1443

 

                  .... AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbb

Query: 0          CUAC-UCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGC 56

                  | |  +*++***+ | || | | || | +++*******||+**+***+ |  *+*****+

Sbjct: 7175       CCAGGACGAGUAUGGUAUAGAACAGGAGACAUAAUAGGAGAUAUAAGAAAAGCAUAUUGU 7234

                  .....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  *+ ||||

Sbjct: 7235       AAGAUUA 7241

                  bb.....

 

 

---------------------------------------------------------------------------

No. 8

GENOME: Cyanophage P-SSM2

NCBI: NC_006883

EMBL: AY939844

Score: 1442

 

                  .. ..AAAAAAAA....  ..........BBBBBBBBBB..aaaaaaaa...bbbbbbbb

Query: 0          CU-ACUCUUGUACAGAA--UGGUAAGCACGUGUAAUAGGAGGUACAAGCCACCCUAUUGC 56

                  || | +++****+ |||  ||||  | | ********+* |+***++*+ | ++****+*

Sbjct: 51009      CUGAUAAGUGUAUUGAAGGUGGU--G-A-GUGUAAUAUG-GUUACUGGA-A-UAUAUUAC 51061

                  .....AAAAAAAA................BBBBBBBBBB..aaaaaaaa...bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  ** | ||

Sbjct: 51062      AUUAAUA 51068

                  bb.....

 

 

---------------------------------------------------------------------------

No. 9

GENOME: Lymphocystis disease virus - isolate China

NCBI: NC_005902

EMBL: AY380826

Score: 1439

 

                  ....   AAAAAAAA...      ......... .. BBBBBBBBBB..aaaaaaaa. .

Query: 0          CUAC---UCUUGUACAGA------AUGGUAAGC-AC-GUGUAAUAGGAGGUACAAGCC-A 47

                  ||||   ++*++**+ ||      || || | | || +***++****||+**++**+  |

Sbjct: 177844     CUACACCAUUGUUAAUGAUGUUUUAU-GUCAUCGACAAUGUUUUAGGAGUUAAGAGAUUA 177902

                  .......AAAAAAAA......................BBBBBBBBBB..aaaaaaaa...

 

 

                  .  bbbbbbbbbb ... .

Query: 48         C--CCUAUUGCAU-AUU-A 62

                     ****++**+* ||| |

Sbjct: 177903     AUUCCUAAAGCUUCAUUGA 177921

                  ...bbbbbbbbbb......

 

 

---------------------------------------------------------------------------

No. 10

GENOME: Ovine pulmonary adenocarcinoma virus, complete genome

NCBI: xxxxxxxx

EMBL: AF105220

Score: 1437

 

                  ....AAAAAAAA..............BBBBBBBBBB.   . aaaaaaaa...bbbbbbb

Query: 0          CUACUCUUGUACAGAAUGGUAAGCACGUGUAAUAGGA---G-GUACAAGCCACCCUAUUG 55

                  | | ****+*+*  |||  | ||   ***+**+***|   | ***+**** | +**+**+

Sbjct: 4214       CAAAUCUUUUGC--AAUCUUGAG---GUGCAAGAGGAAUAGUGUAAAAGCAA-UCUUUUA 4267

                  ....AAAAAAAA..............BBBBBBBBBB......aaaaaaaa...bbbbbbb

 

 

                  bbb  ....

Query: 56   CAU--AUUA 62

                  +**  || |

Sbjct: 4268 AAUCUAUAA 4276

                  bbb......

 

 

---------------------------------------------------------------------------

No. 11

GENOME: HIV-1 isolate 00BW1795.6 from Botswana, complete genome

NCBI: xxxxxxxx

EMBL: AF443097

Score: 1436

 

                  .... AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbb

Query: 0          CUAC-UCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGC 56

                  | |  +*++*+*+   |||  | || | +*+*******||+**+***+ |  *+*****+

Sbjct: 6531       CCAGGACAAGCAUUCUAUGCAACAGGAGAUAUAAUAGGAGAUAUAAGAAAAGCAUAUUGU 6590

                  .....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  *+ ||||

Sbjct: 6591       ACCAUUA 6597

                  bb.....

 

 

---------------------------------------------------------------------------

No. 12

GENOME: Camelpox virus CMS, complete genome

NCBI: xxxxxxxx

EMBL: AY009089

Score: 1434

 

                  .... AAAAAAAA  ........... ...BBBBBBBBBB..aaaaaaaa...  bbbbb

Query: 0          CUAC-UCUUGUAC--AGAAUGGUAAG-CACGUGUAAUAGGAGGUACAAGCCAC--CCUAU 53

                    |  +*****++  |  |||| |||  | +*********| *+*++**+ |   +****

Sbjct: 180916     --AGUACUUGUGUUAAUGAUGGAAAGUUAUAUGUAAUAGGA-GGAUUAGA-AUUUUCUAU 180971

                  .....AAAAAAAA.................BBBBBBBBBB..aaaaaaaa.....bbbbb

 

 

                  bbbbb .   ...

Query: 54   UGCAU-A---UUA 62

                  *+**+ |    ||

Sbjct: 180972     UUCAACAGGCGUA 180984

                  bbbbb........

 

 

---------------------------------------------------------------------------

No. 13

GENOME: Human immunodeficiency virus type 1 genomic RNA, complete genome, clone:93JP-NH2.5T

NCBI: xxxxxxxx

EMBL: AB070352

Score: 1426

 

                  ....AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbbb

Query: 0          CUACUCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGCA 57

                      +*++***+ | || | | || | +++*******| +**+***+ |  *+*****++

Sbjct: 7192       ----ACAAGUAUGGUAUAGAACAGGAGACAUAAUAGGAAAUAUAAGAAAAGCAUAUUGUG 7247

                  ....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbbb

 

 

                  b ....

Query: 58         U-AUUA 62

                  + ||||

Sbjct: 7248       AGAUUA 7253

                  b.....

 

 

---------------------------------------------------------------------------

No. 14

GENOME: Human immunodeficiency virus type 1 genomic RNA, complete genome, clone:93JP-NH2env

NCBI: xxxxxxxx

EMBL: AB070353

Score: 1426

 

                  ....AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbbb

Query: 0          CUACUCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGCA 57

                      +*++***+ | || | | || | +++*******| +**+***+ |  *+*****++

Sbjct: 7183       ----ACAAGUAUGGUAUAGAACAGGAGACAUAAUAGGAAAUAUAAGAAAAGCAUAUUGUG 7238

                  ....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbbb

 

 

                  b ....

Query: 58         U-AUUA 62

                  + ||||

Sbjct: 7239       AGAUUA 7244

                  b.....

 

 

---------------------------------------------------------------------------

No. 15

GENOME: HIV-1 isolate 97CNGX-2F from China, complete genome

NCBI: xxxxxxxx

EMBL: AY008714

Score: 1417

 

                  ....AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbbb

Query: 0          CUACUCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGCA 57

                      +*++***+   || | | || | +++*******||+**+***+ |  *+*****++

Sbjct: 6385       ----ACAAGUAUUCUAUAGAACAGGAGACAUAAUAGGAGAUAUAAGAAAAGCAUAUUGUG 6440

                  ....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbbb

 

 

                  b ....

Query: 58         U-AUUA 62

                  + ||||

Sbjct: 6441       AGAUUA 6446

                  b.....

 

 

---------------------------------------------------------------------------

No. 16

GENOME: HIV-1 isolate 93TH065 from Thailand, complete genome

NCBI: xxxxxxxx

EMBL: AF197339

Score: 1417

 

                  ....AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbbb

Query: 0          CUACUCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGCA 57

                      +*++***+   || | | || | +++*******||+**+***+ |  *+*****++

Sbjct: 7102       ----ACAAGUAUUCUAUAGAACAGGAGACAUAAUAGGAGAUAUAAGAAAAGCAUAUUGUG 7157

                  ....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbbb

 

 

                  b ....

Query: 58         U-AUUA 62

                  + ||||

Sbjct: 7158       AGAUUA 7163

                  b.....

 

 

---------------------------------------------------------------------------

No. 17

GENOME: HIV-1 isolate TH 13-26 from Thailand, complete genome

NCBI: xxxxxxxx

EMBL: AY082968

Score: 1411

 

                  .... AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbb

Query: 0          CUAC-UCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGC 56

                  | |  +*++***+   ||   | || | +++*******||+**+***+ |  *+*****+

Sbjct: 6376       CCAGGACAAGUAUUCUAUCAAACAGGAGACAUAAUAGGAGAUAUAAGAAAAGCAUAUUGU 6435

                  .....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  ++ ||||

Sbjct: 6436       GAGAUUA 6442

                  bb.....

 

 

---------------------------------------------------------------------------

No. 18

GENOME: HIV-1 isolate 97TH6-107 from Thailand, complete genome

NCBI: xxxxxxxx

EMBL: AY125894

Score: 1409

 

                  .... AAAAAAAA......... .....BBBBBBBBBB..aaaaaaaa... bbbbbbbb

Query: 0          CUAC-UCUUGUACAGAAUGGUA-AGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGC 56

                  | |  +*++***+   || | | || | +++*******||+**+***+ |  *+*****+

Sbjct: 6357       CCAGGACAAGUAUUCUAUAGAACAGGAGACAUAAUAGGAGAUAUAAGAAAAGCAUAUUGU 6416

                  .....AAAAAAAA...............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  ++  |||

Sbjct: 6417       GAGGUUA 6423

                  bb.....

 

 

---------------------------------------------------------------------------

No. 19

GENOME: Human immunodeficiency virus 1 DNA, complete genome, clone:ARES2

NCBI: xxxxxxxx

EMBL: AB078005

Score: 1403

 

                  ... . AAAAAAAA..............BBBBBBBBBB..aaaaaaaa... bbbbbbbb

Query: 0          CUA-C-UCUUGUACAGAAUGGUAAGCACGUGUAAUAGGAGGUACAAGCCAC-CCUAUUGC 56

                    | | *+**+***  ||     || | +++*******| +**+***+||  *+*****+

Sbjct: 7110       --AGCAUUUUAUAC--AA----CAGGAGACAUAAUAGGAAAUAUAAGACAAGCAUAUUGU 7161

                  ......AAAAAAAA..............BBBBBBBBBB..aaaaaaaa....bbbbbbbb

 

 

                  bb ....

Query: 57         AU-AUUA 62

                  *+ ||||

Sbjct: 7162       AACAUUA 7168

                  bb.....

 

 

---------------------------------------------------------------------------

No. 20

GENOME: Yaba-like disease virus

NCBI: NC_002642

EMBL: AJ293568

Score: 1402

 

                  ....   AAAAAAAA..............BBBBBBBBBB..aaaaaaaa.. .    bbb

Query: 0          CUAC---UCUUGUACAGAAUGGUAAGCACGUGUAAUAGGAGGUACAAGCCA-C----CCU 51

                   |||   ++**+*+*  ||| ||||  | +***+****+| **++**++ | |    ++*

Sbjct: 115598     -UACAUUAGUUAUGC--AAUUGUAA-UAAUUGUUAUAGUAUGUGUAACAAAGCAAGUUUU 115653

                  .......AAAAAAAA..............BBBBBBBBBB..aaaaaaaa........bbb

 

 

                  bbbbbbb....

Query: 52         AUUGCAUAUUA 62

                  **++**+| |

Sbjct: 115654     AUACCAAAAUG 115664

                  bbbbbbb....

 

 

---------------------------------------------------------------------------